Stem-loop sequence stu-MIR1886b

AccessionMI0025779 (change log)
DescriptionSolanum tuberosum miR1886b stem-loop
Gene family MIPF0001647; MIR1886
Literature search

2 open access papers mention stu-MIR1886b
(3 sentences)

   --    u                     uu  a a 
5'   augg aucgugagaugaaaucagcgu  gg c u
     |||| |||||||||||||||||||||  || |  
3'   uacc uaguacucuacuuuagucgca  uu g g
   ua    u                     uu  a c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137828.1: 1641030-1641099 [-]
Database links

Mature sequence stu-miR1886b

Accession MIMAT0030870

1 - 


 - 24

Get sequence
Evidence experimental; Illumina [1]


PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).