Stem-loop sequence stu-MIR7984c

AccessionMI0025770 (change log)
DescriptionSolanum tuberosum miR7984c stem-loop
Gene family MIPF0001671; MIR7984
Literature search

1 open access papers mention stu-MIR7984c
(1 sentences)

Stem-loop
   --                                                                                a  caucauaaaaau     c    u 
5'   acgauaccaaacuuuaugaaggaccuuuuauucccugcacuauuuaauaguguauuuuaaagguauauaugugcccacgu ga            ugcau auua a
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||            ||||| ||||  
3'   ugcuaugguuugaaauacuuccuggaaaauaagggacgugauaaauuaucacauaaaauuuccauauauacacgggugca cu            augua ugau a
   aa                                                                                c  ------------     a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138777.1: 6817-7020 [-]
intergenic
Database links

Mature sequence stu-miR7984c-5p

Accession MIMAT0030861
Sequence

1 - 

acgauaccaaacuuuaugaaggac

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR7984c-3p

Accession MIMAT0031185
Sequence

181 - 

ccuucauaaaguuugguaucguaa

 - 204

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).