Stem-loop sequence stu-MIR5303d

AccessionMI0025767 (change log)
DescriptionSolanum tuberosum miR5303d stem-loop
Gene family MIPF0001432; MIR5303
Literature search

4 open access papers mention stu-MIR5303d
(13 sentences)

Stem-loop
   --acc   c               aua 
5'      cgu ucggauucuccaaaa   c
        ||| |||||||||||||||   a
3'      gca agccuaagagguuuu   c
   cccac   c               cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138193.1: 69372-69426 [-]
intergenic
Database links

Mature sequence stu-miR5303d

Accession MIMAT0030858
Sequence

32 - 

uuuuggagaauccgacacgcaccc

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).