Stem-loop sequence stu-MIR7984b

AccessionMI0025762 (change log)
DescriptionSolanum tuberosum miR7984b stem-loop
Gene family MIPF0001671; MIR7984
Literature search

1 open access papers mention stu-MIR7984b
(1 sentences)

Stem-loop
   --        c    -    u                             -                  g   c  g        cauaaaaauugcau 
5'   auaccgaa uuug gaaa gaccuuuuaccccugcacuauuuaauagu uauuuuaaagguauauau ugc ca guggacau              c
     |||||||| |||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||| ||| || ||||||||               
3'   uaugguuu aaau cuuu cuggaaaauggggaugugauaaauuauca auaaaauuuccauauaua acg gu caucugug              a
   gc        a    a    -                             c                  a   a  g        caaugauaaauauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138511.1: 123046-123240 [-]
intergenic
Database links

Mature sequence stu-miR7984b-5p

Accession MIMAT0030853
Sequence

1 - 

auaccgaacuuuggaaaugaccuu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR7984b-3p

Accession MIMAT0031184
Sequence

172 - 

ggucuuucauaaaauuugguaucg

 - 195

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).