Stem-loop sequence bta-mir-664b

AccessionMI0025533 (change log)
DescriptionBos taurus miR-664b stem-loop
Gene family MIPF0000300; mir-664
Literature search

3 open access papers mention bta-mir-664b
(3 sentences)

Stem-loop 
   -c     a     aa   u         aa 
5'   aggcu ggaga  uga uggauagaa  u
     ||||| |||||  ||| |||||||||  u
3'   uccga ccucu  auu acuuaucuu  u
   ca     c     --   u         au
Get sequence
Deep sequencing
1817 reads, 40.5 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 24479316-24479375 [-]
sense
ENSBTAT00000059594 ; SNORA36-201; exon 1
ENSBTAT00000047860 ; RAB3GAP2-201; intron 9
Database links

Mature sequence bta-miR-664b

Accession MIMAT0030438
Sequence

38 -  

uauucauuuaucucccagccuac

 - 60

Get sequence
Deep sequencing447 reads, 67 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).