Stem-loop sequence ptc-MIR6476c

AccessionMI0025469 (change log)
DescriptionPopulus trichocarpa miR6476c stem-loop
Gene family MIPF0001687; MIR6476
Stem-loop
             --g     u        -a    ga  --g  -ac      g 
5' uggagaugcg   aucag ggagauga  acau  uu   cu   agcauu c
   ||||||||||   ||||| ||||||||  ||||  ||   ||   ||||||  
3' auuuuuaugu   ugguu ccuuuauu  ugug  aa   ga   uuguga u
             aag     -        gg    uc  gua  aau      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR6476c

Accession MIMAT0030369
Sequence

13 - 

ucaguggagaugaaacauga

 - 32

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).