Stem-loop sequence hhi-mir-449

AccessionMI0025419 (change log)
DescriptionHippoglossus hippoglossus miR-449 stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   ugug     ug c    a       u uu  u       uga  g 
5'     guggg  g ugga ggcagug c  gu agcuggu   uu u
       |||||  | |||| ||||||| |  || |||||||   ||  
3'     caccu  c accu ccgucgu g  ca ucgaccg   ag g
   ---a     gu a    c       c uc  u       -ug  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-449

Accession MIMAT0030340
Sequence

18 - 

aggcagugucuuguuagcugguug

 - 41

Get sequence
Evidence experimental; SOLiD [1]

References

1