Stem-loop sequence bdi-MIR167e

AccessionMI0025298 (change log)
DescriptionBrachypodium distachyon miR167e stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

2 open access papers mention bdi-MIR167e
(7 sentences)

Stem-loop 
   caugugca   u  a   u         g                u  - ----          ga ug 
5'         cca ac agc ggugaagcu ccagcaugaucugauc ga c    cauauaucua  u  g
           ||| || ||| ||||||||| |||||||||||||||| || |    ||||||||||  |   
3'         ggu ug ucg cuacuuuga ggucguacuggacuag cu g    guguauaggu  g  c
   -------g   -  g   u         -                u  a uaua          ag ua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 1641440-1641565 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR167e
bdi-MIR167f4: 1643731-1643832 [-]
bdi-MIR167e4: 1641440-1641565 [-]
Database links

Mature sequence bdi-miR167e-5p

Accession MIMAT0030091
Sequence

22 -  

ugaagcugccagcaugaucuga

 - 43

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence bdi-miR167e-3p

Accession MIMAT0030092
Sequence

95 -  

aggucaugcuggaguuucauc

 - 115

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).
2
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).