Stem-loop sequence oar-mir-200b

Accession

MI0025265 (change log)

Description

Ovis aries miR-200b stem-loop

Gene family

MIPF0000019; mir-8

Literature search

7 open access papers mention oar-mir-200b
(10 sentences)

Stem-loop

   c    -    ug     c      u  ug 
5'  cauc uuac  ggcag auugga gg  u
    |||| ||||  ||||| |||||| ||  c
3'  guag aaug  ccguc uaaucu cu  u
   a    u    gu     a      -  gg 

Deep sequencing

16462 reads, 4.35e+03 reads per million, 13 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Oar_v4.0; GCA_000298735.2): chr12: 49327356-49327414 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from oar-mir-200b

• oar-mir-200b: chr12: 49327356-49327414 [-]
• oar-mir-200a: chr12: 49326773-49326858 [-]

Database links

• miRBase Tracker:MI0025265

Mature sequence oar-miR-200b

• Accession: MIMAT0030043
• Sequence: 38 - uaauacugccugguaaugaug - 58
• Deep sequencing: 16194 reads, 13 experiments
• Evidence: experimental; cloned [1]

References

1. PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).