Stem-loop sequence osa-MIR1437b

AccessionMI0025198 (change log)
DescriptionOryza sativa miR1437b stem-loop
Gene family MIPF0001762; MIR1437
Literature search

1 open access papers mention osa-MIR1437b
(1 sentences)

Stem-loop
                                   a     c                  a   a                                    a  -     ----  c         --  a    c  caa 
5' cggaggaaggaggccggcgcacagaggacgag gguga ggcgcguggggagggagg aac gugccuagugcggcgccggagcucgccagcacgcgg ag gaggu    ag ggcgguggc  gg gcgc gg   g
   |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| || |||||    || |||||||||  || |||| ||    
3' gccuccuuccuccggccgcgugucuccugcuc ccacu ccgcgcgccccucccucc uug cacggaucacgccguggccucgagcggucgugcguc uc cucca    uc cugccgccg  cc cgcg cc   c
                                   g     a                  c   c                                    c  a     cucc  -         gu  -    -  ucu 
Get sequence
Deep sequencing
92 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 3955862-3956129 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1437b
osa-MIR1437aChr8: 3955902-3956089 [+]
osa-MIR1437bChr8: 3955862-3956129 [-]
Database links

Mature sequence osa-miR1437b-5p

Accession MIMAT0029953
Sequence

52 - 

gggaggaaacagugccuagug

 - 72

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence osa-miR1437b-3p

Accession MIMAT0029954
Sequence

175 - 

gugcuggcgagcuccggugccgca

 - 198

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; 454 [1]

References

1