Stem-loop sequence bta-mir-2285u

AccessionMI0025197 (change log)
DescriptionBos taurus miR-2285u stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285u
(15 sentences)

Stem-loop 
   -  a  a    ---  c           u    a   caa          cc 
5'  gg gu ugcu   gg guuggccaaaa guuc uuc   uuuuucugua  a
    || || ||||   || ||||||||||| |||| |||   ||||||||||   
3'  cc ua auga   cc caaucgguuuu caag aag   aaaaagacau  u
   c  a  a    uaa  -           u    c   ccc          uc
Get sequence
Deep sequencing
3952 reads, 10.4 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 73356047-73356147 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-2285u
bta-mir-2285uchr13: 73356047-73356147 [+]
bta-mir-2284y-2chr13: 73356056-73356133 [-]
Database links

Mature sequence bta-miR-2285u

Accession MIMAT0031094
Sequence

57 -  

gaaaaacccgaacgaacuuu

 - 76

Get sequence
Deep sequencing3942 reads, 66 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).