Stem-loop sequence bta-mir-133c

AccessionMI0025193 (change log)
DescriptionBos taurus miR-133c stem-loop
Gene family MIPF0000029; mir-133
Literature search

12 open access papers mention bta-mir-133c
(42 sentences)

Stem-loop 
      auc     gca    c       u   g           c  cg 
5' gcc   aaugc   gcua agcuggu gaa gggaccaaauc au  a
   |||   |||||   |||| ||||||| ||| ||||||||||| ||   
3' ugg   uuacg   cgau ucgacca uuu ccuugguuuag ug  a
      --c     aaa    u       u   a           u  ac
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 55446233-55446326 [+]
antisense
ENSBTAT00000050863 ; bta-mir-133a-1-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-133c
bta-mir-133cchr13: 55446233-55446326 [+]
bta-mir-133a-1chr13: 55446236-55446330 [-]
Database links

Mature sequence bta-miR-133c

Accession MIMAT0029949
Sequence

56 -  

auuugguuccauuuuaccagc

 - 76

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).