Stem-loop sequence pmi-mir-125

AccessionMI0025106 (change log)
DescriptionPatiria miniata miR-125 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   cgucaaaauau   -    u      c        c     u    a  ga u 
5'            gcc cagu cucagu ccugagac cuaac ugug uu  g g
              ||| |||| |||||| |||||||| ||||| |||| ||  |  
3'            ugg gucg ggguua ggacucug gauug acac aa  c a
   ------acgag   c    c      a        u     u    c  ga a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-125-5p

Accession MIMAT0032158
Sequence

25 - 

ucccugagacccuaacuuguga

 - 46

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).