Stem-loop sequence ipu-mir-454b

AccessionMI0024632 (change log)
DescriptionIctalurus punctatus miR-454b stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   --     ---         cu       ucuca 
5'   ccuau   caauauugc  cugcuuu     c
     |||||   |||||||||  |||||||     u
3'   ggaua   guuauaacg  gaugagg     g
   ug     uuc         -u       uauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-454b

Accession MIMAT0029511
Sequence

41 - 

uagugcaauauugcuuauagggu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1