Stem-loop sequence lja-MIR7537

AccessionMI0024422 (change log)
DescriptionLotus japonicus miR7537 stem-loop
Stem-loop
       --c   uu  --aau    uaaaauauu  a g           a   a    cuu      u      g --   uc  a      uaa      ggucaaguuagac 
5' gcaa   ggu  cu     ugug         gg u guguuaaguuc uuc ugaa   aggaaa acgccu c  ggu  cu auugug   aauguu             c
   ||||   |||  ||     ||||         || | ||||||||||| ||| ||||   |||||| |||||| |  |||  || ||||||   ||||||              
3' cguu   cua  ga     acac         cc a caugauucaag agg auuu   uucuuu ugugga g  cca  ga uaacac   uuacaa             c
       uaa   gg  cuuuu    ---------  c g           c   g    -uc      -      g ua   ga  c      uga      aauagacugaugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr1: 42455050-42455260 [+]
intergenic
Clustered miRNAs
< 10kb from lja-MIR7537
lja-MIR7537Chr1: 42455050-42455260 [+]
lja-MIR2111Chr1: 42456511-42456663 [+]
Database links

Mature sequence lja-miR7537

Accession MIMAT0029363
Sequence

56 - 

uaggaaauacgccugcgguucc

 - 77

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).