Stem-loop sequence hcmv-mir-UL69

AccessionMI0024165 (change log)
DescriptionHuman cytomegalovirus miR-UL69 stem-loop
Stem-loop
   ag             c  --    ---      gg 
5'   gccagaggcuaag cg  aaac   cguccg  g
     ||||||||||||| ||  ||||   ||||||   
3'   ugguuuccgauuc gc  uuug   gcgggc  a
   cg             a  cu    agc      ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 96898-96964 [+]
intergenic
Clustered miRNAs
< 10kb from hcmv-mir-UL69
hcmv-mir-UL59HEHCMVCG: 94602-94667 [+]
hcmv-mir-UL69HEHCMVCG: 96898-96964 [+]
hcmv-mir-UL70HEHCMVCG: 103087-103152 [+]
Database links

Mature sequence hcmv-miR-UL69

Accession MIMAT0029123
Sequence

4 - 

ccagaggcuaagccgaaaccg

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).