Stem-loop sequence hcmv-mir-UL59

AccessionMI0024164 (change log)
DescriptionHuman cytomegalovirus miR-UL59 stem-loop
Stem-loop
        ----g        cu       c  uucu 
5' cgacg     uucucucg  cgucaug cg    g
   |||||     ||||||||  ||||||| ||     
3' gcugc     aagagagc  gcgguac gc    a
        gguaa        ag       a  cucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 94602-94667 [+]
intergenic
Clustered miRNAs
< 10kb from hcmv-mir-UL59
hcmv-mir-UL59HEHCMVCG: 94602-94667 [+]
hcmv-mir-UL69HEHCMVCG: 96898-96964 [+]
hcmv-mir-UL70HEHCMVCG: 103087-103152 [+]
Database links

Mature sequence hcmv-miR-UL59

Accession MIMAT0029122
Sequence

6 - 

guucucucgcucgucaugccgu

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).