Stem-loop sequence sbi-MIR5568f

AccessionMI0023534 (change log)
DescriptionSorghum bicolor miR5568f stem-loop
Gene family MIPF0001377; MIR5568
Literature search

2 open access papers mention sbi-MIR5568f
(3 sentences)

Stem-loop
   ----gua      ca                        u  c     c       -------c       cu 
5'        uuacuc  uccauuccaaauuguaagauguuu gg uuuuc agauaua        acuaugu  a
          ||||||  |||||||||||||||||||||||| || ||||| |||||||        |||||||   
3'        gaugag  agguaagguuuaauauucuguaaa uc aaaag ucuaugu        ugauaca  g
   cauguuc      ag                        c  a     a       aaagaaaa       ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 63095416-63095552 [-]
intergenic
Database links

Mature sequence sbi-miR5568f-5p

Accession MIMAT0026442
Sequence

12 - 

uccauuccaaauuguaagaug

 - 32

Get sequence
Evidence not experimental

Mature sequence sbi-miR5568f-3p

Accession MIMAT0026443
Sequence

103 - 

gucuuauaauuuggaauggag

 - 123

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).