Stem-loop sequence sbi-MIR5568e

AccessionMI0023532 (change log)
DescriptionSorghum bicolor miR5568e stem-loop
Gene family MIPF0001377; MIR5568
Literature search

2 open access papers mention sbi-MIR5568e
(3 sentences)

Stem-loop
      uu    a    c   c uau     ag         g                --cuc         ac     ua  u 
5' uau  uacu ccuc auu c   uuaua  auguuuugg uuuucuagauauauau     uugcuaugu  uugga  ua a
   |||  |||| |||| ||| |   |||||  ||||||||| ||||||||||||||||     |||||||||  |||||  || c
3' aua  auga ggag uaa g   aauau  ugcaaaauc aaaagaucuaugugug     aaugauaca  gaucu  au a
      uc    g    a   a uuu     -g         g                accaa         aa     gc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 4815913-4816076 [+]
intergenic
Database links

Mature sequence sbi-miR5568e-5p

Accession MIMAT0026438
Sequence

30 - 

gauguuuuggguuuucuagau

 - 50

Get sequence
Evidence not experimental

Mature sequence sbi-miR5568e-3p

Accession MIMAT0026439
Sequence

115 - 

uaucuagaaaagcuaaaacgu

 - 135

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).