Stem-loop sequence sbi-MIR6230

AccessionMI0023531 (change log)
DescriptionSorghum bicolor miR6230 stem-loop
Literature search

2 open access papers mention sbi-MIR6230
(3 sentences)

Stem-loop
         a       u    a                         u        g    caucccuaaacuuauaaaauggugcacc 
5' guccac aacuuug aaac cauuuuugggucccuaaacuuguua guggugca cgca                            g
   |||||| ||||||| |||| ||||||||||||||||||||||||| |||||||| ||||                             
3' cgggug uugaaac uuug guaaagaucuagggauuugaacaau caccgcgu gugu                            c
         c       u    c                         u        g    caccagccauaccaggucuuuaccugga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 50124113-50124288 [+]
intergenic
Database links

Mature sequence sbi-miR6230-5p

Accession MIMAT0026436
Sequence

24 - 

uuuugggucccuaaacuuguu

 - 44

Get sequence
Evidence not experimental

Mature sequence sbi-miR6230-3p

Accession MIMAT0026437
Sequence

132 - 

uaacaaguuuagggaucuaga

 - 152

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).