Stem-loop sequence sbi-MIR2118

AccessionMI0023526 (change log)
DescriptionSorghum bicolor miR2118 stem-loop
Gene family MIPF0000745; MIR2118
Literature search

2 open access papers mention sbi-MIR2118
(3 sentences)

Stem-loop
         ---au g         aaaa   g                       -a   g           ---u    a g 
5' gugggc     g aagaggaag    gag gucuaagagcagugggcauggga  cau uaggaaggccu    ugag u g
   ||||||     | |||||||||    ||| |||||||||||||||||||||||  ||| |||||||||||    |||| |  
3' cacucg     c uucuccuuc    cuc uggauucuuguuauccguacccu  gua guccuucuggg    acuc a a
         guuuu g         ----   g                       cc   -           uuuu    g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 45483175-45483326 [-]
intergenic
Database links

Mature sequence sbi-miR2118-5p

Accession MIMAT0026426
Sequence

42 - 

ggcaugggaacauguaggaagg

 - 63

Get sequence
Evidence not experimental

Mature sequence sbi-miR2118-3p

Accession MIMAT0026427
Sequence

93 - 

uuccugaugccucccaugccua

 - 114

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).