Stem-loop sequence sbi-MIR5568d

AccessionMI0023524 (change log)
DescriptionSorghum bicolor miR5568d stem-loop
Gene family MIPF0001377; MIR5568
Literature search

2 open access papers mention sbi-MIR5568d
(3 sentences)

Stem-loop
             cc   -a                                       c    cac      aua 
5' cacccucugu  caa  uuguaggucguuuuggcuuuucuagauacauagcuuuug uaug   uuagau   u
   ||||||||||  |||  ||||||||||||||||||||||||||||||||||||||| ||||   ||||||   g
3' gugggaggca  guu  aauguccagcaaaaccgaaaagaucuauguguugaaaau auac   gaucua   a
             -a   aa                                       a    aua      cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr3: 65618892-65619038 [+]
intergenic
Database links

Mature sequence sbi-miR5568d-5p

Accession MIMAT0026422
Sequence

30 - 

uggcuuuucuagauacauagc

 - 50

Get sequence
Evidence not experimental

Mature sequence sbi-miR5568d-3p

Accession MIMAT0026423
Sequence

95 - 

aaaguuguguaucuagaaaag

 - 115

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).