Stem-loop sequence sbi-MIR6225

AccessionMI0023523 (change log)
DescriptionSorghum bicolor miR6225 stem-loop
Literature search

1 open access papers mention sbi-MIR6225
(2 sentences)

Stem-loop
       c   uac   c      c         auc  c   u                c                ug          a  cuucac             a     a     a                    u    c   u 
5' uaau aug   uaa uagacu aaaagauuc   uc cga uuauagauaaauugug aauuaguuuuuguuuu  ucuauauuua ug      gcaugugcuguaa auucg uauga gggaaaucuugaaaaguuuu ggua uuu u
   |||| |||   ||| |||||| |||||||||   || ||| |||||||||||||||| ||||||||||||||||  |||||||||| ||      ||||||||||||| ||||| ||||| |||||||||||||||||||| |||| |||  
3' auua uau   auu aucuga uuuucuaag   ag guu aaugucuguuuaauau uuaaucaaaaauaaaa  agauauaaau ac      cguacacggcauu uaagu auacu cccuuuagaacuuuucaaaa ccau aaa g
       u   uaa   a      a         caa  c   u                a                gu          c  aaauua             c     a     a                    c    c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr3: 10003904-10004207 [-]
intergenic
Database links

Mature sequence sbi-miR6225-5p

Accession MIMAT0026420
Sequence

13 - 

aacuagacucaaaagauucaucuc

 - 36

Get sequence
Evidence not experimental

Mature sequence sbi-miR6225-3p

Accession MIMAT0026421
Sequence

269 - 

gaaacgaaucuuuuaagucuaauu

 - 292

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).