Stem-loop sequence sbi-MIR437x

AccessionMI0023516 (change log)
DescriptionSorghum bicolor miR437x stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437x
(5 sentences)

Stem-loop
                a         g             ---    cua       c    ac         c  a           aaaugcuaagauuuauaguaccaaaauaauaccauuaaauuuauuau 
5' uacucccuccguc cugaaagcu uaauuucuagagu   uguc   agucaaa uuuu  aacuuugau aa uuuauagaaaa                                               a
   ||||||||||||| ||||||||| |||||||||||||   ||||   ||||||| ||||  ||||||||| || |||||||||||                                               g
3' augagggaggcag ggcuuucga guugaggaucuua   acag   ucaguuu aaaa  uugaaacug uu aaauauuuuuu                                               a
                a         a             ggc    ---       a    aa         a  a           cucauaguuauagauacuguauuuuauucauauaaaauuuuuauaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 21931891-21932151 [+]
intergenic
Database links

Mature sequence sbi-miR437x-5p

Accession MIMAT0026406
Sequence

32 - 

uagaguuguccuaagucaaacuuu

 - 55

Get sequence
Evidence not experimental

Mature sequence sbi-miR437x-3p

Accession MIMAT0026407
Sequence

210 - 

auuugacugacacggauucuagga

 - 233

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).