Stem-loop sequence sbi-MIR5568c

AccessionMI0023513 (change log)
DescriptionSorghum bicolor miR5568c stem-loop
Gene family MIPF0001377; MIR5568
Literature search

2 open access papers mention sbi-MIR5568c
(3 sentences)

Stem-loop
          a                   c              aaa            a       uau     c g 
5' guacucc ucuguuccaaauuguaagu guuuuggcuuucuu   uacauaguuuuu cuaugca   agaca a u
   ||||||| ||||||||||||||||||| ||||||||||||||   |||||||||||| |||||||   ||||| | g
3' caugagg aggcaagguuugacauuca caaaaccgaaagga   auguaucgaaaa gauacgu   uuugu u c
          g                   a              ccc            c       uuu     a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 20734250-20734404 [-]
intergenic
Database links

Mature sequence sbi-miR5568c-5p

Accession MIMAT0026400
Sequence

9 - 

ucuguuccaaauuguaagucg

 - 29

Get sequence
Evidence not experimental

Mature sequence sbi-miR5568c-3p

Accession MIMAT0026401
Sequence

129 - 

acuuacaguuuggaacggagg

 - 149

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).