Stem-loop sequence sbi-MIR5568b

AccessionMI0023512 (change log)
DescriptionSorghum bicolor miR5568b stem-loop
Gene family MIPF0001377; MIR5568
Literature search

2 open access papers mention sbi-MIR5568b
(3 sentences)

Stem-loop
      -   uuaa     uuauc         --cucccu      -----c         gucauuuaaa                 cuuuu      caucu 
5' aca ggu    ucaaa     uaguaugua        cuauuc      aaauuguaa          cuuuucuagguacauag     gcuaug     a
   ||| |||    |||||     |||||||||        ||||||      |||||||||          |||||||||||||||||     ||||||      
3' ugu cca    aguuu     aucauauau        gaugag      uuuaacauu          gaaaagaucuauguauc     ugauac     u
      a   ---c     ---uu         uaauuuac      acaaac         aaacaagauc                 auuuu      aucga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 46400021-46400212 [-]
intergenic
Database links

Mature sequence sbi-miR5568b-5p

Accession MIMAT0026388
Sequence

64 - 

uuucuagguacauagcuuuug

 - 84

Get sequence
Evidence not experimental

Mature sequence sbi-miR5568b-3p

Accession MIMAT0026389
Sequence

112 - 

acuauguaucuagaaaagcua

 - 132

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).