Stem-loop sequence sbi-MIR5568g

AccessionMI0023506 (change log)
DescriptionSorghum bicolor miR5568g stem-loop
Gene family MIPF0000344; MIR818
Literature search

2 open access papers mention sbi-MIR5568g
(3 sentences)

Stem-loop
          -uu aua        c   a                      g   u           u      a        ca   c g 
5' uaaauau   g   uguacucc uuc uuccaaauuauaagauguuuug cuu uuuagauacau gcuguu uuauguau  aga a c
   |||||||   |   |||||||| ||| |||||||||||||||||||||| ||| ||||||||||| |||||| ||||||||  ||| | g
3' guuuaua   c   guaugagg agg gagguuuaauauucugcaaaac gaa agaucugugua cgauaa gauacgug  ucu u u
          ugu gaa        a   c                      a   u           u      c        aa   a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr3: 55813821-55814000 [+]
intergenic
Database links

Mature sequence sbi-miR5568g-5p

Accession MIMAT0026465
Sequence

30 - 

caaauuauaagauguuuuggc

 - 50

Get sequence
Evidence not experimental

Mature sequence sbi-miR5568g-3p

Accession MIMAT0026466
Sequence

133 - 

aaaacgucuuauaauuuggag

 - 153

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).