Stem-loop sequence ccr-mir-124b

AccessionMI0023430 (change log)
DescriptionCyprinus carpio miR-124b stem-loop
Gene family MIPF0000021; mir-124
Literature search

3 open access papers mention ccr-mir-124b
(8 sentences)

Stem-loop
   aa     c  u   g  --a     c   ug    a   guaug 
5'   ggccc uc cuu gc   uucac gcg  ccuu auu     g
     ||||| || ||| ||   ||||| |||  |||| |||      
3'   ccggg gg gag cg   aagug cgc  ggaa uaa     a
   --     c  u   a  cac     c   cu    c   auuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-124b

Accession MIMAT0026334
Sequence

52 - 

ucaagguccgccgugaacacgc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).