Stem-loop sequence ccr-mir-7133

AccessionMI0023429 (change log)
DescriptionCyprinus carpio miR-7133 stem-loop
Literature search

1 open access papers mention ccr-mir-7133
(1 sentences)

Stem-loop
   aag    -uca       -  u     g        u           -uc   c 
5'    ggug    guggaga ca gcucu gugcugug guuaaacugua   guu u
      ||||    ||||||| || ||||| |||||||| |||||||||||   |||  
3'    cuac    uaucucu gu ugaga cacgacac uaguuugauau   caa a
   ---    uucg       c  u     a        u           cca   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-7133

Accession MIMAT0026333
Sequence

64 - 

uaguuugauucacagcacaaga

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).