Stem-loop sequence ccr-mir-7132

AccessionMI0023428 (change log)
DescriptionCyprinus carpio miR-7132 stem-loop
Gene family MIPF0002098; mir-7132
Literature search

1 open access papers mention ccr-mir-7132
(1 sentences)

Stem-loop
   --      uu  uu   u     g     g              u  ca  u 
5'   ugaguu  gu  gag cccuu acuug ucuaagcuccucag gu  ug g
     ||||||  ||  ||| ||||| ||||| |||||||||||||| ||  ||  
3'   acucaa  ca  uuc gggaa ugaac agauuugaggaguc ca  ac a
   cu      -c  uu   u     a     g              -  -a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-7132

Accession MIMAT0026332
Sequence

60 - 

ugaggaguuuagagcaaguaa

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).