Stem-loop sequence ccr-mir-124a

AccessionMI0023427 (change log)
DescriptionCyprinus carpio miR-124a stem-loop
Gene family MIPF0000021; mir-124
Literature search

3 open access papers mention ccr-mir-124a
(8 sentences)

Stem-loop
   -      g ca     c   ug    a   -gu  g 
5'  uuucuu g  uucac gcg  ccuu auu   au g
    |||||| |  ||||| |||  |||| |||   ||  
3'  aaagaa c  aagug cgc  ggaa uaa   ua a
   a      g ac     u   cu    c   auu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-124a

Accession MIMAT0026331
Sequence

45 - 

ucaagguccgcugugaacac

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).