Stem-loop sequence ccr-mir-132b

AccessionMI0023426 (change log)
DescriptionCyprinus carpio miR-132b stem-loop
Literature search

2 open access papers mention ccr-mir-132b
(5 sentences)

Stem-loop
   gaag   -     -    a      a    ug    c      ca a    c 
5'     uuu cuguc ccau gcgacc uggc  uaga uguuac  g agua u
       ||| ||||| |||| |||||| ||||  |||| ||||||  | ||||  
3'     gaa gacag ggua cgcugg accg  aucu acaaug  c ucgu g
   --ga   c     a    c      c    ua    a      -a a    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-132b

Accession MIMAT0026330
Sequence

21 - 

accauggcuguagacuguuacc

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).