Stem-loop sequence ccr-mir-551

AccessionMI0023425 (change log)
DescriptionCyprinus carpio miR-551 stem-loop
Gene family MIPF0000360; mir-551
Literature search

1 open access papers mention ccr-mir-551
(2 sentences)

Stem-loop
        uu   c     -     ug     gug   ug   c 
5' cugug  gcc uagaa ccaag  ugggu   gcc  gau u
   |||||  ||| ||||| |||||  |||||   |||  |||  
3' gacau  cgg gucuu gguuc  accca   cgg  uug u
        uu   a     u     cu     --g   ua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-551

Accession MIMAT0026329
Sequence

50 - 

gcgacccauccuugguuucug

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).