Stem-loop sequence ccr-mir-7b

AccessionMI0023417 (change log)
DescriptionCyprinus carpio miR-7b stem-loop
Gene family MIPF0000022; mir-7
Literature search

3 open access papers mention ccr-mir-7b
(3 sentences)

Stem-loop
   gaac     -    cuu     u  a     u       u     ug  aguu 
5'     gcugg cuug   cugug gg agacu gugauuu guugu  uu    a
       ||||| ||||   ||||| || ||||| ||||||| |||||  ||     
3'     cgacc ggac   gacau cc ucugg cacuaaa caaca  ga    g
   ---a     c    -ac     c  g     -       -     gu  agua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-7b

Accession MIMAT0026320
Sequence

22 - 

uggaagacuugugauuuuguugu

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).