Stem-loop sequence ccr-mir-729

AccessionMI0023413 (change log)
DescriptionCyprinus carpio miR-729 stem-loop
Stem-loop
   ca   au         g      ug  a   a  uau  au 
5'   ucc  ugacccggg uuguau  ua cca gc   gc  c
     |||  ||||||||| ||||||  || ||| ||   ||   
3'   agg  auugggucc agcaua  au ggu cg   ug  u
   --   gc         -      gu  g   a  --u  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-729

Accession MIMAT0026316
Sequence

50 - 

cauggguaugauacgaccuggg

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).