Stem-loop sequence ccr-mir-727

AccessionMI0023412 (change log)
DescriptionCyprinus carpio miR-727 stem-loop
Gene family MIPF0001371; mir-727
Literature search

1 open access papers mention ccr-mir-727
(2 sentences)

Stem-loop
   ac       u      c            cuccca   cg    -   - g 
5'   cuguaug cauuuu agucuucaauuc      gcc  uaac cau g a
     ||||||| |||||| ||||||||||||      |||  |||| ||| |  
3'   gacaugu gugaaa ucagaaguugag      cgg  guug gug c a
   --       c      u            ------   -a    a   u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-727-5p

Accession MIMAT0026314
Sequence

16 - 

ucagucuucaauuccucccagc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ccr-miR-727-3p

Accession MIMAT0026315
Sequence

59 - 

guugaggcgaguugaagacuua

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).