Stem-loop sequence ccr-mir-726

AccessionMI0023411 (change log)
DescriptionCyprinus carpio miR-726 stem-loop
Literature search

1 open access papers mention ccr-mir-726
(2 sentences)

Stem-loop
        c     c    aa   c      uc      a  c  g 
5' ucagu guaug cugg  uuc gcuagu  ugaacu uu gu a
   ||||| ||||| ||||  ||| ||||||  |||||| || || u
3' aguca cauau ggcu  aag cgauca  acuuga aa cg u
        a     a    -c   a      uc      a  -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-726

Accession MIMAT0026313
Sequence

55 - 

uucacuacuagcagaacucgg

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).