Stem-loop sequence ccr-mir-722

AccessionMI0023408 (change log)
DescriptionCyprinus carpio miR-722 stem-loop
Gene family MIPF0001612; mir-722
Literature search

3 open access papers mention ccr-mir-722
(5 sentences)

Stem-loop
   acu                           a  c      guuu  aug 
5'    ggaacagaauggaauuugaaacguuuu gc aaaaau    cc   g
      ||||||||||||||||||||||||||| || ||||||    ||    
3'    ucuugucuugcuuuagacuuugcaaag cg uuuuug    gg   u
   ---                           a  u      ---u  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-722

Accession MIMAT0026310
Sequence

59 - 

uuuuuugcagaaacguuucag

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).