Stem-loop sequence ccr-mir-454b

AccessionMI0023400 (change log)
DescriptionCyprinus carpio miR-454b stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   ggc          ---         cu       uucca 
5'    gagacccuau   caauauugc  cugcuuu     c
      ||||||||||   |||||||||  |||||||     u
3'    uucugggaua   guuauaacg  gaugagg     g
   ---          uuc         -u       uauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-454b

Accession MIMAT0026300
Sequence

49 - 

uagugcaauauugcuuauagg

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).