Stem-loop sequence ccr-mir-430

AccessionMI0023398 (change log)
DescriptionCyprinus carpio miR-430 stem-loop
Gene family MIPF0000003; mir-430
Literature search

2 open access papers mention ccr-mir-430
(15 sentences)

Stem-loop 
   cuaucgg      c    -       g   ugucug 
5'        uacccu acaa uggcacu acu      u
          |||||| |||| ||||||| |||       
3'        augggg uguu aucguga ugg      u
   ----uug      u    u       a   uuuaug
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-430

Accession MIMAT0026298
Sequence

46 -  

uaagugcuauuuguugggguag

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).