Stem-loop sequence ccr-mir-375

AccessionMI0023395 (change log)
DescriptionCyprinus carpio miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

1 open access papers mention ccr-mir-375
(1 sentences)

Stem-loop
   u     uuu      c    c c    u     ac   c    u    --g a 
5'  gugug   ucugua uugu u acgu gagcc  acg acaa accu   c g
    |||||   |||||| |||| | |||| |||||  ||| |||| ||||   |  
3'  cgcac   agacgu gacg a ugcg cucgg  ugc uguu ugga   g a
   -     ---      a    c u    -     cu   u    u    aaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-375

Accession MIMAT0026295
Sequence

63 - 

uuuguucguucggcucgcguua

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).