Stem-loop sequence ccr-mir-365

AccessionMI0023394 (change log)
DescriptionCyprinus carpio miR-365 stem-loop
Gene family MIPF0000061; mir-365
Literature search

1 open access papers mention ccr-mir-365
(8 sentences)

Stem-loop
   --a      aa        ac           -----    u   u 
5'    gcaaga  aaugaggg  uuuuaggggca     gcug guu u
      ||||||  ||||||||  |||||||||||     |||| ||| a
3'    cguucu  uuauuccu  aaaauccccgu     ugac caa u
   uaa      cg        -a           aauac    c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-365

Accession MIMAT0026294
Sequence

54 - 

uaaugccccuaaaaauccuuau

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).