Stem-loop sequence ccr-mir-301a

AccessionMI0023388 (change log)
DescriptionCyprinus carpio miR-301a stem-loop
Gene family MIPF0000034; mir-130
Literature search

1 open access papers mention ccr-mir-301a
(3 sentences)

Stem-loop
   acaucaagu      aa        c    --uu -        a  -  auu 
5'          gcuguu  caggugcu ugac    c auugcacu cu gu   g
            ||||||  |||||||| ||||    | |||||||| || ||    
3'          cgacga  gucuacga acug    g uaacguga ga cg   g
   ---------      ga        a    uuau a        c  u  aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-301a

Accession MIMAT0026288
Sequence

60 - 

cagugcaauaguauugucaaagc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).