Stem-loop sequence ccr-mir-29a

AccessionMI0023386 (change log)
DescriptionCyprinus carpio miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

2 open access papers mention ccr-mir-29a
(3 sentences)

Stem-loop
   cccaucuc      ccaa gg            cuc       u   - u uc 
5'         ucccca    a  augacugauuuc   uggugcu aga g c  u
           ||||||    |  ||||||||||||   ||||||| ||| | |   
3'         aggggu    u  uauuggcuaaag   accacga ucu c g  u
   --uuaacu      -cag aa            uuu       -   a u uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-29a

Accession MIMAT0026286
Sequence

63 - 

uagcaccauuugaaaucgguua

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).