Stem-loop sequence ccr-mir-27d

AccessionMI0023385 (change log)
DescriptionCyprinus carpio miR-27d stem-loop
Gene family MIPF0000036; mir-27
Literature search

3 open access papers mention ccr-mir-27d
(13 sentences)

Stem-loop 
   --   aag      c            auug       ---u   c 
5'   ucu   cgggug agagcuuagcug    gugaaca    gca g
     |||   |||||| ||||||||||||    |||||||    ||| c
3'   aga   guccac ucuugaaucggu    cacuugu    ugu u
   aa   aaa      u            --ga       uuuu   u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-27d

Accession MIMAT0026285
Sequence

55 -  

uucacaguggcuaaguucuuc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).