Stem-loop sequence ccr-mir-24

AccessionMI0023380 (change log)
DescriptionCyprinus carpio miR-24 stem-loop
Gene family MIPF0000041; mir-24
Literature search

1 open access papers mention ccr-mir-24
(2 sentences)

Stem-loop
   cu  u       g       u     uaa     gg  g 
5'   gg cuccugu ccugcug gcuga   ucagu  au g
     || ||||||| ||||||| |||||   |||||  ||  
3'   uc ggggaca ggacgac ugacu   ggucg  ug c
   --  u       a       u     --c     -a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-24

Accession MIMAT0026279
Sequence

48 - 

uggcucaguucagcaggaacag

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).