Stem-loop sequence ccr-mir-23a

AccessionMI0023378 (change log)
DescriptionCyprinus carpio miR-23a stem-loop
Gene family MIPF0000027; mir-23
Literature search

1 open access papers mention ccr-mir-23a
(2 sentences)

Stem-loop 
   cc      --a gg           a       -gg     
5'   agcugg   g  auuccuggcag gugauuu   gauu 
     ||||||   |  ||||||||||| |||||||   ||| a
3'   ucgacc   c  uagggaccguu cacuaaa   cuau 
   --      aac uu           a       aua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-23a

Accession MIMAT0026277
Sequence

48 -  

aucacauugccagggauuucc

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).