Stem-loop sequence ccr-mir-22b

AccessionMI0023377 (change log)
DescriptionCyprinus carpio miR-22b stem-loop
Gene family MIPF0000053; mir-22
Literature search

1 open access papers mention ccr-mir-22b
(1 sentences)

Stem-loop
   c      u     uc        -     u       -u   g 
5'  guugcu cacag  guucuuca cuggc aguuuua  gug c
    |||||| |||||  |||||||| ||||| |||||||  |||  
3'  caaugg guguu  cgagaagu gaccg ucgaaau  cac u
   -      -     gu        u     -       uc   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-22b

Accession MIMAT0026276
Sequence

52 - 

aagcugccaguugaagagcugu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).