Stem-loop sequence ccr-mir-222

AccessionMI0023375 (change log)
DescriptionCyprinus carpio miR-222 stem-loop
Gene family MIPF0000051; mir-221
Literature search

1 open access papers mention ccr-mir-222
(6 sentences)

Stem-loop
       u     cuuc             -     g c   uc 
5' gacg ccauc    gcucaguggucag uguag u cug  u
   |||| |||||    ||||||||||||| ||||| | |||  c
3' cugc gguag    ugggucaucgguc acauc a gac  c
       c     ucuc             u     g c   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-222

Accession MIMAT0026274
Sequence

50 - 

agcuacaucuggcuacuggg

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).