Stem-loop sequence ccr-mir-217

AccessionMI0023371 (change log)
DescriptionCyprinus carpio miR-217 stem-loop
Gene family MIPF0000077; mir-217
Literature search

1 open access papers mention ccr-mir-217
(1 sentences)

Stem-loop
   guuuga    gc         ugauac                u  augaua 
5'       ucuu  ugauguugg      ugcaucaggaacugau gg      u
         ||||  |||||||||      |||||||||||||||| ||       
3'       agaa  gcuacgacu      acguaguucuugacua cc      c
   ------    -a         ucccuc                -  gaggau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-217

Accession MIMAT0026270
Sequence

25 - 

uacugcaucaggaacugauugga

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).